seqparse

Parse sequence files (GenBank, FASTA, JBEI, SnapGene, SBOL) or accession IDs (NCBI, iGEM) to a simple, common format:

``ts
interface Seq {
name: string;
type: "dna" | "rna" | "aa" | "unknown";
seq: string;
annotations: Annotation[];
}

interface Annotation {
name: string;
start: number;
end: number;
direction?: number;
color?: string;
type?: string;
}
`

Installation

`bash
npm i seqparse
`

To install the CLI globally:

`bash
npm i -g seqparse
`

Examples

$3

`ts
import seqparse from "seqparse";

const { name, type, seq, annotations } = await seqparse(file);
`

$3

Example outputs are truncated for clarity.

`bash


parse files

$ seqparse pBbE0c-RFP.gb
{
"name": "pBbE0c-RFP",
"type": "dna",
"seq": "cagctagctcagtcctaggtactgtgctagctacta...",
"annotations": [
{
"name": "colE1 origin",
"start": 1234,
"end": 1917,
"direction": -1,
"type": "rep_origin"
},
...

parse files from stdin

$ cat pBbE0c-RFP.fasta | seqparse
{
"name": "pBbE0c-RFP.1",
"type": "dna",
"seq": "cagctagctcagtcctagg...",
"annotations": []
}

parse files then use jq to get seqs alone

$ seqparse j5.SBOL.xml | jq -r '.seq'
ggcagcaaggtctacggcaaggaacagtttttgcggatgcgccagagcatgttccccgatcgc

fetch and parse remote sequence files from NCBI

$ seqparse NC_011521
{
"name": "NC_011521",
"type": "dna",
"seq": "cccatcttaagacttcacaagactt...",
"annotations": [
{
"name": "HS566_RS00005",
"start": 6,
"end": 285,
"direction": -1,
"type": "gene"
},
...
``